View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_47 (Length: 317)
Name: NF16912_low_47
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 92 - 298
Target Start/End: Original strand, 38677688 - 38677906
Alignment:
| Q |
92 |
cgttttttgctctagtgagaaacatgcgtgagacacgtgaccgttggaagaacaaaatgagtgaaaatattaaggaagaaaatagagttgttggtgtttg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38677688 |
cgttttttgctctagtgagaaacatgcgtgagacacgtgaccgttggaggaacaaaatgagtgaaaatattaaggaagaaaatagagttgttggtgtttg |
38677787 |
T |
 |
| Q |
192 |
gaagcctacgtttaaacttgaagatttcgctgaagagggtgcatctaagagcaataa------------taatattattaaggaagatgacacagaaaaa |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38677788 |
gaagcctacgtttaaacttgaagatttcgctgaagagggtgcatctaagagcaataatattaactgtgctaatattattaaggaagatgacacagaaaaa |
38677887 |
T |
 |
| Q |
280 |
ggtattaacttgaagctct |
298 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38677888 |
ggtattaacttgaagctct |
38677906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University