View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_52 (Length: 302)
Name: NF16912_low_52
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 7e-49; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 182 - 284
Target Start/End: Complemental strand, 10434480 - 10434378
Alignment:
| Q |
182 |
ccttaacacaacctataatcttattatactaatcacataagcttctcttagaattcatatatttgattttctaaacccaatcaacaaacactaaccaagc |
281 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10434480 |
ccttaacacatcctataatcttattatactaatcacataagcttctcttagaattcatatatttgattttctaaacccaatcaacaaacactaaccaagc |
10434381 |
T |
 |
| Q |
282 |
ttg |
284 |
Q |
| |
|
||| |
|
|
| T |
10434380 |
ttg |
10434378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 51 - 112
Target Start/End: Complemental strand, 10434605 - 10434544
Alignment:
| Q |
51 |
tactgttaataacaagggggaaaataaacatgtaaaaagtaacatgaatattaattttgtaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10434605 |
tactgttaataacaagggggaaaataaacatgtaaaaagtaacatgaatattaattttgtaa |
10434544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 5 - 36
Target Start/End: Complemental strand, 10434649 - 10434618
Alignment:
| Q |
5 |
aaatgtgaaattagcttaaacaaaaatgcatt |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10434649 |
aaatgtgaaattagcttaaacaaaaatgcatt |
10434618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University