View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_59 (Length: 270)
Name: NF16912_low_59
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 39084176 - 39084428
Alignment:
| Q |
1 |
aggtgatggaggagaagggagagagacatgatttttcggagaatttgccggaaataatggaagggagaccagattatttgaataggcagatttcagggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39084176 |
aggtgatggaggagaagggagagagacatgatttttcggagaatttgccggaaataatggaagggagaccagattatttgaataggcagatttcagggaa |
39084275 |
T |
 |
| Q |
101 |
agggtggaagcctagcttggatactattaaggagaagaatattgagaaaaaacatactcattggttgttcctcaagagtttttagtggtatagttatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39084276 |
agggtggaagcctagcttggatactattaaggagaagaatattgagaaaaaacatactcattggttgttcctcaagagtttttagtggtatagttatttt |
39084375 |
T |
 |
| Q |
201 |
agttttggttagtagttaaataaatattgtggattaatgttgggtattattat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39084376 |
agttttggttagtagttaaataaatattgtggattaatgttgggtattattat |
39084428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 139
Target Start/End: Complemental strand, 44729815 - 44729752
Alignment:
| Q |
76 |
atttgaataggcagatttcagggaaagggtggaagcctagcttggatactattaaggagaagaa |
139 |
Q |
| |
|
|||||| |||||| | |||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
44729815 |
atttgagtaggcaattatcagggaaagggtggaagcctagcttggatacaattaaggaaaagaa |
44729752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University