View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_60 (Length: 261)
Name: NF16912_low_60
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 43 - 253
Target Start/End: Original strand, 23934955 - 23935165
Alignment:
| Q |
43 |
tacattgatctcagtttgataattgttgtttgaaaaatggaatgggtccacttgatcttccatgtaatcctagtattccatttatacaccatcgaagcac |
142 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23934955 |
tacattgatctcagtttgagaattgttgtttgaaaaatggaatgggtccacttgatcttccatgtaatcctagtattccatttatacaccatcgaagcac |
23935054 |
T |
 |
| Q |
143 |
aaacattagaaacaacaaccatatcaagagacaacttaaccatcatgtttgttggttttttatctgccataattttaatggccttgtttgcactcttact |
242 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23935055 |
aatcattagaaacaacaaccatatcaagagacaacttaaccatcatgtttgttggttttttatctgccttaattttaatggccttgtttgcactcttact |
23935154 |
T |
 |
| Q |
243 |
ccgcctttgct |
253 |
Q |
| |
|
||||| ||||| |
|
|
| T |
23935155 |
ccgccattgct |
23935165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University