View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_66 (Length: 250)
Name: NF16912_low_66
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 2834208 - 2834422
Alignment:
| Q |
1 |
tgatccaattgtgcggagtttttaaaagtatatcaaaacatgctgtagaatatgtaagttaagttcgtgcttaaatttgaaaggatttcataaggtatag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2834208 |
tgatccaattgtgcggagtttttaaaagtatatcaaaacatgctgtacaatatgtaagttaagttcgtgcttaaatttgaaaggatttcataaggtatag |
2834307 |
T |
 |
| Q |
101 |
ctccgtggttttaaattcgatctttgcatctgtttaggttgatttggtggtgtaagtgtgccccttctgaatgttttagattcgatttttctatgtgtct |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
2834308 |
ttccgtggttttaaa-tcgatctttgcatctgtttaggttgatttggtggtgtaagtgtgcctctcctgaatgttttaaattcgatttttctatgtgtct |
2834406 |
T |
 |
| Q |
201 |
atttaggtggataaat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2834407 |
atttaggtggataaat |
2834422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University