View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_69 (Length: 244)
Name: NF16912_low_69
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_69 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 72 - 244
Target Start/End: Complemental strand, 48706846 - 48706673
Alignment:
| Q |
72 |
taaatatttttgttttgttatccgcacttccttccaagtccaacactcccattttctacaactagatgcaggaaggaatcgcacgtaaatactatatcaa |
171 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||| |||||||||| ||||||||| |
|
|
| T |
48706846 |
taaatatttttgttttgttaaccgcacttccttccaagtccaacactcccattttctataactatatgcatgaaggaatagcacgtaaattctatatcaa |
48706747 |
T |
|
| Q |
172 |
gaagtctttgttcacaaaatatcatgaaacacgttacggtttaaataaatcaa-ttttcttttgggtcgatgga |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48706746 |
gaagtctttgttcacaaaatatcatgaaacacgttacggtttaaataaatcaatttttcttttgggtcgatgga |
48706673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 7 - 74
Target Start/End: Complemental strand, 48707623 - 48707561
Alignment:
| Q |
7 |
tatgtgtgaaggtttgtccctcatctacagagcagcatttcaaatgcagtttgtttgtttgaccttaa |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48707623 |
tatgtgtgaaggtttgtccctcatctacagagcagcatt-----tgcagtttgtttgtttgaccttaa |
48707561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University