View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_72 (Length: 238)
Name: NF16912_low_72
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_72 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 48706405 - 48706625
Alignment:
| Q |
18 |
tgatttagattatcacaattggtggtttaatcctcttaaatgtcttgtttatatttcttaggatgcagttttagtttgtgttttgttatggttgtctatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48706405 |
tgatttagattatcacaattggtggtttaatcctcttaagtgtcttgtttatgtttcttacgatgcagttttagtttgtgttttgttatggttgtctatt |
48706504 |
T |
 |
| Q |
118 |
gtttgttaagaaccatttgtgctggaagggcttgtttgatgtgattatatttatatacaattcattttggtgttttcaaaataaatgtcgagattattac |
217 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48706505 |
gtttgttaagaactatttgtgttggaagggcttgtttgatgtgattatatttatatacaattcattttggtgttttcaaaataaatgtcgatattattac |
48706604 |
T |
 |
| Q |
218 |
attaaacacttttacgaactt |
238 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
48706605 |
attgaacacttttacgaactt |
48706625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 12653613 - 12653688
Alignment:
| Q |
29 |
atcacaattggtggtttaatcctcttaaatgtcttgtttatatttcttaggatgcagttttagtttgtgttttgtt |
104 |
Q |
| |
|
|||||||| ||||| ||||||||||||| || ||||||||| ||||||| | |||| ||||||||||| ||||||| |
|
|
| T |
12653613 |
atcacaatcggtggcttaatcctcttaagtgccttgtttatgtttcttaagctgcatttttagtttgtattttgtt |
12653688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University