View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16912_low_76 (Length: 237)

Name: NF16912_low_76
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16912_low_76
NF16912_low_76
[»] chr1 (1 HSPs)
chr1 (18-133)||(42236131-42236246)
[»] chr4 (1 HSPs)
chr4 (126-221)||(41537581-41537676)
[»] chr6 (1 HSPs)
chr6 (155-217)||(17402575-17402637)


Alignment Details
Target: chr1 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 18 - 133
Target Start/End: Complemental strand, 42236246 - 42236131
Alignment:
18 aggttgatgttgaagtgtttcttagtctacgttcatcgtctagtttcttggctgtgatgagaataagtgtttcttggattgtccaattacctttacggta 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42236246 aggttgatgttgaagtgtttcttagtctacgttcatcgtctagtttcttggctgtgatgagaataagtgtttcttggattgtccaattacctttacggta 42236147  T
118 ttctctggtggaggag 133  Q
    |||||||| |||||||    
42236146 ttctctggaggaggag 42236131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 126 - 221
Target Start/End: Complemental strand, 41537676 - 41537581
Alignment:
126 tggaggagcagagggtggttatttgggaaggtgaggtggcggattggatggtggagacgagttcttgggatttagtgacggaatctagggtgtagg 221  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41537676 tggaggtgcagagggtggttatttgggaaggtgaggtggcggattggatggtggagacgagttcttgggatttagtgacggaatctagggtgtagg 41537581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 217
Target Start/End: Original strand, 17402575 - 17402637
Alignment:
155 ggtgaggtggcggattggatggtggagacgagttcttgggatttagtgacggaatctagggtg 217  Q
    |||| |||||||||||||||||| |||| ||| ||||||||||| | |||| |||||| ||||    
17402575 ggtgtggtggcggattggatggttgagaggaggtcttgggatttggagacgaaatctaaggtg 17402637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University