View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_77 (Length: 234)
Name: NF16912_low_77
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_77 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 34523975 - 34524203
Alignment:
| Q |
1 |
atattgtgatgttgttacagagttgtggcaagagtttatcttattatcctacaatgcctccaccagatgcatcttaaatcttaatgtactaaacattgac |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34523975 |
atattgtgatgttgttaccgagttgtggcaagagtttatcttattatcctacaatgcctccaccagatgcatcttaaatcttaatgtactaaacattgat |
34524074 |
T |
|
| Q |
101 |
agctgataaattgaattttgatatgatcaacgattgtatgtaggatttacttccacgttaagataaaacatatttgtgatatgacattccatattcagcc |
200 |
Q |
| |
|
| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34524075 |
atctgataaattgaattttgacatgatcaacgattgtatgtaggatttacttccacgttaagataaaacatatttgtgatatgacattccatattcagcc |
34524174 |
T |
|
| Q |
201 |
aacttagatggtgatgcagtcgatgatgt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34524175 |
aacttagatggtgatgcagtcgatgatgt |
34524203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University