View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_83 (Length: 223)
Name: NF16912_low_83
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_83 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 206
Target Start/End: Complemental strand, 46521467 - 46521271
Alignment:
| Q |
14 |
ataattctcacataaaataaaatatttcttttaactcactctttagtctttatgaacctatatatgctctataactctgaactctataaaccaa----gc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46521467 |
ataattctcacataaaataaaatatttcttttaactcactctttagtctttatgaacctatatatgctctataactctgaactctataaaccaaccaagc |
46521368 |
T |
|
| Q |
110 |
tgaaaggaattgacttaatgcaacccaagtatttgttttcttattatgtggatttggtgaaacaaattaaggtacaagggtattgcttcaattatat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46521367 |
tgaaaggaattgacttaatgcaacccaagtatttgttttcttattatgtggatttggtgaaacaaattaaggtacaagggtattgcttcaattatat |
46521271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University