View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_89 (Length: 204)
Name: NF16912_low_89
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_89 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 80 - 186
Target Start/End: Complemental strand, 45651175 - 45651069
Alignment:
| Q |
80 |
atgtagatctgattggatttgaatccatagatctaatttaaaactcacataaacaattatggaacaactgaaacataaattttgcttataattcataaaa |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45651175 |
atgtagatctgattggatttgaatccatagatctaatttaaaactcacataaacaattatggaacaactaaaacataaattttgcttataattcataaaa |
45651076 |
T |
 |
| Q |
180 |
catgaaa |
186 |
Q |
| |
|
||||||| |
|
|
| T |
45651075 |
catgaaa |
45651069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University