View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16913_high_11 (Length: 240)
Name: NF16913_high_11
Description: NF16913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16913_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 14433493 - 14433270
Alignment:
| Q |
1 |
atgcaaggaaggttaactaacaatgtgtttaattttattttgtaggaatacaaaaatgcaattaatatattgcattcaaggatgtttcaatggggtggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14433493 |
atgcaaggaaggttaactaacaatgcgtttaattttattttgtaggaatacaaaaatgcaattaatatattgcattcaaggatgtttcaatggggtggtg |
14433394 |
T |
|
| Q |
101 |
atgttgctgtgtatgataaaaatgaatcttacatagaggtggtgacctccccaaacaaccctgatggaacccttcgtgtaccagtggtgaactctgcagc |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14433393 |
atgctgctgtgtatgataaaaatgaatcttacatagaggtggtgacttccccaaacaaccctgatggaacccttcgtgtaccagtggtgaactctgcagc |
14433294 |
T |
|
| Q |
201 |
taaagggaaattgattcatgactt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
14433293 |
taaagggaaattgattcatgactt |
14433270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 34 - 194
Target Start/End: Complemental strand, 14441791 - 14441631
Alignment:
| Q |
34 |
tttattttgtaggaatacaaaaatgcaattaat-atattgcattcaaggatgtttcaatggggtggtgatgttgctgtgtatgataaaaatgaatcttac |
132 |
Q |
| |
|
|||||||||||||||||| || ||| ||| || ||| |||| |||||| | ||||||||||||||||||| |||| |||||||| |||| || ||||| |
|
|
| T |
14441791 |
tttattttgtaggaataccaagatgtgattgatcata-tgcaatcaaggctatttcaatggggtggtgatgctgctttgtatgatgaaaacaaaccttac |
14441693 |
T |
|
| Q |
133 |
atagaggtggtgacctccccaaacaaccctgatggaacccttcgtgtaccagtggtgaactc |
194 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
14441692 |
atagaggtagtgacctccccaaacaaccctgatgggactcttcgaacaccagtggtgaactc |
14441631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University