View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16913_high_15 (Length: 215)
Name: NF16913_high_15
Description: NF16913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16913_high_15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 42063223 - 42063437
Alignment:
| Q |
1 |
ccagtcaccacaagagcaatgtaagcagaggaattgatcacgggaaaggtaaatgttattctctctgggggtggttttggcgagtcgttaattgaggtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42063223 |
ccagtcaccacaagagcaatgtaagcagaggaattgatcacgggaaaggtaaatgttattctctctgggggtggttttggcgagtcgttaattgaggtaa |
42063322 |
T |
|
| Q |
101 |
cccattttttattctcatggacaagagggtgacctgggaacagagaagctacatgcccatcaggacccatgccaagcaacatgagatcaaattttggaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42063323 |
cccattttttattctcatggacaagagggtgacctgggaacagagaagctacatgcccatcaggacccatgccaagcaacatgagatcaaattttggaaa |
42063422 |
T |
|
| Q |
201 |
tccactggctgatga |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42063423 |
tccactggctgatga |
42063437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 214
Target Start/End: Original strand, 9514335 - 9514516
Alignment:
| Q |
33 |
attgatcacgggaaaggtaaatgttattctctctgggggtggttttggcgagtcgttaattgaggtgacccattttttattctcatggacaagagggtga |
132 |
Q |
| |
|
||||||||| ||||| || || || |||||||||| ||||||||||| ||||| | | | || |||||||| | || ||| |||| ||||| ||| |
|
|
| T |
9514335 |
attgatcactggaaaagtgaaagtaattctctctgatggtggttttggtgagtcagtgaggaaagtaacccatttctgatcctcttggagaagagcatga |
9514434 |
T |
|
| Q |
133 |
cctgggaacagagaagctacatgcccatcaggacccatgccaagcaacatgagatcaaattttggaaatccactggctgatg |
214 |
Q |
| |
|
|||||||| | ||| || ||||| ||||| |||||||| || || | |||||||||||||||||| |||||| ||| ||||| |
|
|
| T |
9514435 |
cctgggaataaagatgcaacatgtccatccggacccatacctaggagcatgagatcaaattttggtaatccattggttgatg |
9514516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University