View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16913_high_4 (Length: 360)
Name: NF16913_high_4
Description: NF16913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16913_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 14 - 352
Target Start/End: Original strand, 55568838 - 55569177
Alignment:
| Q |
14 |
tttacaactatcctatatgggatttgatcccctctcgaggtt-ccgagtccagttctaaccagctggacagtatgtatgtatgtatgttattggaatctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55568838 |
tttacaactatcctatatgggatttgatcccctctcgaggttgccgagtccagttctaaccagctggacagtatgtatgtatgtatgttattggaatctt |
55568937 |
T |
 |
| Q |
113 |
aacacccatcaatcatattttgtacaagtctaaatagaattggcggaggatatgttttgttattatgattttggctttggtttttacagtgtagtttaat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55568938 |
aacacccatcaatcatattttgtacaagtctaaatagaattggcggaggatatgttttgttattatgattttggctttggttttttcagtgtagtttaat |
55569037 |
T |
 |
| Q |
213 |
aatctttcatattatagtctgtctttctcgctatttgaatggagttataacatgtgtttgannnnnnnnnnggcctgttacagaagtatggaaagataga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55569038 |
aatctttcatattatagtctgtctttctcgcaatttgaatggagttataacatgtgtttgattttttttttggcctgttacagaagtatggaaagataga |
55569137 |
T |
 |
| Q |
313 |
tgtcgttgtgtccaatgctgctgcaaatccttctgatgat |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55569138 |
tgtcgttgtgtccaatgctgctgcaaatccttctgttgat |
55569177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University