View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16913_low_13 (Length: 259)
Name: NF16913_low_13
Description: NF16913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16913_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 19755522 - 19755757
Alignment:
| Q |
10 |
attattctaaatatgtataatgagcagcctggtaagtattgaatgagaatccgtgttttttccttaattaagggtgaatgagaatgtgttgcgccctttc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19755522 |
attattctaaatatgtataatgagcagccttgtaagtattgaatgagaatccgtgttttttccttaattaagggtgaatgagaatgtgttgcgccctttc |
19755621 |
T |
 |
| Q |
110 |
taaattgttctatgaatagactagatgtgtttgaatgttgctctttaggcatccaatgattactcttagacatctatcaaacgacagttaaaagtgtttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19755622 |
taaattgttctatgaatagactagatgtgtttgaatgttgctctttaggcacccaatgattactcttagacatctatcgaacgacagttaaaagtgtttt |
19755721 |
T |
 |
| Q |
210 |
aaactgtagttaactatcgtttggatttactaagtg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19755722 |
aaactgtagttaactatcgtttggatttactaagtg |
19755757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University