View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16913_low_19 (Length: 234)
Name: NF16913_low_19
Description: NF16913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16913_low_19 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 234
Target Start/End: Complemental strand, 14433757 - 14433531
Alignment:
| Q |
8 |
tcatcatttagttggaaatgctgtgaccaaagataaatacatagttgttggaaatggctcttctcaactcttccaagctgctttgtttgctttgtctcct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14433757 |
tcatcatttagttggaaatgctgtgaccaaagataaatacatagttgttggaaatggctcttctcaactcttccaagctgctttgttcgctttgtctcct |
14433658 |
T |
|
| Q |
108 |
ttagatgtccctgatcaccctatcaatgttgtttctcctactccttattactcggtgatctttctttcttataaacaaaatggtctcgtatacagactaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14433657 |
ttagatgtccctgatcaccctatcaatgttatttctcctactccttattactcggtgatctttctttcttataaacaaaatggtctcgtatacagactaa |
14433558 |
T |
|
| Q |
208 |
aaatgtctcgtatattaaaatatgttt |
234 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
14433557 |
aaatgtctcgtatattaaaatatgttt |
14433531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 171
Target Start/End: Complemental strand, 14443164 - 14443011
Alignment:
| Q |
18 |
gttggaaatgctgtgaccaaagataaatacatagttgttggaaatggctcttctcaactcttccaagctgctttgtttgctttgtctcctttagatgtcc |
117 |
Q |
| |
|
||||| |||| ||| || |||||||| | |||||| | |||||||||||| ||||||| ||| | ||| ||||| ||| | ||||||| |||| | |
|
|
| T |
14443164 |
gttggtaatgttgtcacaaaagataagttcatagtgttaggaaatggctctactcaacttttcaatgctcttttgtatgcactctctccttcagatccct |
14443065 |
T |
|
| Q |
118 |
ctgatcaccctatcaatgttgtttctcctactccttattactcggtgatctttc |
171 |
Q |
| |
|
||||||| ||||||||||||||| || || |||||||||||||||| ||||||| |
|
|
| T |
14443064 |
ctgatcaacctatcaatgttgttgctgctgctccttattactcggtaatctttc |
14443011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University