View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16913_low_20 (Length: 215)

Name: NF16913_low_20
Description: NF16913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16913_low_20
NF16913_low_20
[»] chr3 (1 HSPs)
chr3 (1-215)||(42063223-42063437)
[»] chr1 (1 HSPs)
chr1 (33-214)||(9514335-9514516)


Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 42063223 - 42063437
Alignment:
1 ccagtcaccacaagagcaatgtaagcagaggaattgatcacgggaaaggtaaatgttattctctctgggggtggttttggcgagtcgttaattgaggtga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
42063223 ccagtcaccacaagagcaatgtaagcagaggaattgatcacgggaaaggtaaatgttattctctctgggggtggttttggcgagtcgttaattgaggtaa 42063322  T
101 cccattttttattctcatggacaagagggtgacctgggaacagagaagctacatgcccatcaggacccatgccaagcaacatgagatcaaattttggaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42063323 cccattttttattctcatggacaagagggtgacctgggaacagagaagctacatgcccatcaggacccatgccaagcaacatgagatcaaattttggaaa 42063422  T
201 tccactggctgatga 215  Q
    |||||||||||||||    
42063423 tccactggctgatga 42063437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 214
Target Start/End: Original strand, 9514335 - 9514516
Alignment:
33 attgatcacgggaaaggtaaatgttattctctctgggggtggttttggcgagtcgttaattgaggtgacccattttttattctcatggacaagagggtga 132  Q
    ||||||||| ||||| || || || ||||||||||  ||||||||||| |||||  | |   | || |||||||| | || ||| |||| |||||  |||    
9514335 attgatcactggaaaagtgaaagtaattctctctgatggtggttttggtgagtcagtgaggaaagtaacccatttctgatcctcttggagaagagcatga 9514434  T
133 cctgggaacagagaagctacatgcccatcaggacccatgccaagcaacatgagatcaaattttggaaatccactggctgatg 214  Q
    |||||||| | ||| || ||||| ||||| |||||||| || || | |||||||||||||||||| |||||| ||| |||||    
9514435 cctgggaataaagatgcaacatgtccatccggacccatacctaggagcatgagatcaaattttggtaatccattggttgatg 9514516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University