View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16914_low_7 (Length: 254)
Name: NF16914_low_7
Description: NF16914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16914_low_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 20 - 254
Target Start/End: Complemental strand, 37429647 - 37429412
Alignment:
| Q |
20 |
tccgacaactatacgatcagtcccagatttagatctatcttccacttctctcttttcatcacaagtaatgtcactgcccaattctgtactcccactaata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37429647 |
tccgacaactatacgatcagtcccagatttagatctatcttccacttctctcttgtcatcactagtaatgtcactgcccaattctgtactcccactaatg |
37429548 |
T |
 |
| Q |
120 |
tcggtcccactattatttgaagatgagcaccgaggggatggatgaaaagaaatttgttttgaggcctgttcctcatttgtggcaggagactttttagcag |
219 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37429547 |
tcggtcccactattatttgaagatgagtaccaaggggatggatgaaaagaaatttgttttgaggcctgttcctcatttgtggcaggagactttgtagcag |
37429448 |
T |
 |
| Q |
220 |
ctc-atctgcttcacttgcttgtgatggtggaattc |
254 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37429447 |
ctctttctgcttcacttgcttgtgatggtggaattc |
37429412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University