View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16915_low_5 (Length: 380)

Name: NF16915_low_5
Description: NF16915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16915_low_5
NF16915_low_5
[»] chr6 (3 HSPs)
chr6 (134-244)||(33393318-33393430)
chr6 (310-364)||(33393197-33393252)
chr6 (8-57)||(33393507-33393553)


Alignment Details
Target: chr6 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 134 - 244
Target Start/End: Complemental strand, 33393430 - 33393318
Alignment:
134 ctatcagagcaatgctatat--gtcccgaattattcttcgggaaatatcacgagcgtgtatttgtgacttcaagtaaaaagaaaaagagcatagttttat 231  Q
    ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33393430 ctatcagagcaatgctatatatgtcccgaattattcttcgggaaatatcacgagcgtgtatttgtgacttcaagtaaaaagaaaaagagcatagttttat 33393331  T
232 attttgaatagac 244  Q
    |||||||||||||    
33393330 attttgaatagac 33393318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 310 - 364
Target Start/End: Complemental strand, 33393252 - 33393197
Alignment:
310 aagaaaattagggtaaaaaa-gttgatgtaattgattaaaattttaaactagatac 364  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
33393252 aagaaaattagggtaaaaaaagttgatgtaattgattaaaattttaaactagatac 33393197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 33393553 - 33393507
Alignment:
8 catcatcacgtggtttcgtttttgttatgtttaattatagtgttttgttg 57  Q
    |||||||||||||||||||||||   ||||||||||||||||||||||||    
33393553 catcatcacgtggtttcgttttt---atgtttaattatagtgttttgttg 33393507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University