View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16915_low_6 (Length: 331)
Name: NF16915_low_6
Description: NF16915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16915_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 12 - 319
Target Start/End: Original strand, 11368751 - 11369059
Alignment:
| Q |
12 |
tttcttcataactttggtctccaagttcaatgtttattatggtaagttgcaatgattaagtttttgttttgtctaccctgttcaatgtgaatgataataa |
111 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11368751 |
tttcttcataactttggtctccaagctcaatgtttattatggtaagttacaatgattaagtttttgttttgtctaccctgttcaatgtgaatgataataa |
11368850 |
T |
|
| Q |
112 |
aggattggatgtaggttaaaattagcaatgcaagatttcttatttcagtttttaaaaattagttgtttga-ccgctctctttatgaatgatcataaatga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
11368851 |
aggattggatgtaggttaaaattagcaatgcaagatttcttatttcagtttttaaaaattagttgtttgatccgccctctttatgaatgatcataaatga |
11368950 |
T |
|
| Q |
211 |
ttggacgtcgggttcattgctaactttcatcctcaccaaagctaagtttcagtctgccactctttttaaccactggataacaaaattagatagtcgtatt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11368951 |
ttggacgtcgggttcattgctaactttcatcctcaccaaagctaagtttcagtctgccactctttttaaccactggataacaaaattagatagtcgtatt |
11369050 |
T |
|
| Q |
311 |
cacatgttc |
319 |
Q |
| |
|
||||||||| |
|
|
| T |
11369051 |
cacatgttc |
11369059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 257 - 319
Target Start/End: Original strand, 11369062 - 11369124
Alignment:
| Q |
257 |
tttcagtctgccactctttttaaccactggataacaaaattagatagtcgtattcacatgttc |
319 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11369062 |
tttcagtctgccactctttctaaccactagataacaaaattagatagtcgtattcacatgttc |
11369124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University