View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16916_high_10 (Length: 240)
Name: NF16916_high_10
Description: NF16916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16916_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 3706270 - 3706062
Alignment:
| Q |
1 |
ttgttcttgtcgacaccattcctgacaaactacgaggtgagatgctagagctacgacatgctgcggccttcctcccccgtactaagatccaggcctccac |
100 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3706270 |
ttgttcttgttgacgccattcctgacaaactacgaggtgagatgctggatctacaacatgctgcggccttcctcccccgcactaagatccaggcctccac |
3706171 |
T |
 |
| Q |
101 |
tgactattcagtgacgatggggtctgacctctgcatcgtcactgctggggctcgccagattaatggcgagtccagattgaatttgctacaaaggaatgta |
200 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3706170 |
tgactattcagtgacgatgggttccgacctctgcatcgtcactgctggggctcgtcagattaatggcgagtccagattgaatttgctacaaaggaatgta |
3706071 |
T |
 |
| Q |
201 |
gctttgttt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
3706070 |
gctttgttt |
3706062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University