View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16916_low_14 (Length: 212)
Name: NF16916_low_14
Description: NF16916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16916_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 195
Target Start/End: Original strand, 7542383 - 7542562
Alignment:
| Q |
16 |
caaaatcatcattaaggaggttatgtccaaacatagacaaagaagatggattggaaactgttcttgaaatacctatacctgaagaaatgttttcaaacat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542383 |
caaaatcatcattaaggaggttatgtccaaacatagacaaagaagatggattggaaactgttcttgaaatacctatacctgaagaaatgttttcaaacat |
7542482 |
T |
 |
| Q |
116 |
gggaagtaatgtgacattaagatggcaaaatatgttaacatggatgaaggctcaaactgaggataaattgtcttccccta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542483 |
gggaagtaatgtgacattaagatggcaaaatatgttaacatggatgaaggctcaaactgaggataaattgtcttccccta |
7542562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University