View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16916_low_15 (Length: 209)
Name: NF16916_low_15
Description: NF16916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16916_low_15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 209
Target Start/End: Complemental strand, 43410570 - 43410375
Alignment:
| Q |
11 |
ttgttgttgaaatgtagcagtaattgcttagtatcaagatcctcctgcagctgctgatggtagtcctggatattaatattagatgcatgcatgaaggcat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410570 |
ttgttgttgaaatgtagcagtaattgcttagtatcaagatcctcctgcagctg---atggtagtcctggatattaatattagatgcatgcatgaaggcat |
43410474 |
T |
|
| Q |
111 |
gatcaactcctaaaggagctcctgtagggttttctgtcatcacaacatgatgatggttaatggcagtagtagtagtcataggtaatttgtttcctgcat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410473 |
gatcaactcctaaaggagctcctgtagggttttctgtcatcacaacatgatgatggttaatggcagtagtagtagtcataggtaatttgtttcctgcat |
43410375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University