View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16918_low_5 (Length: 274)
Name: NF16918_low_5
Description: NF16918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16918_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 11 - 266
Target Start/End: Original strand, 26181669 - 26181924
Alignment:
| Q |
11 |
cacagaacagggtaactatcccgaatagtgaaacagatgattccattgcaatcgccggaacatctactgaaatcatctgtattcaaattatgaggtaaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26181669 |
cacagaacagggtaactatcccgaatagtgaaacagatgattccattgcaatcgccggaacatctactgaaatcatctgtattcaaattatgaggcaaag |
26181768 |
T |
|
| Q |
111 |
ggagtggggtctgtgattgtgatagtgtgttgaaaactgaagttatatgggtacaagtgaaaccgttgttttgaagcatgaggagatggtggtggttctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26181769 |
ggagtggggtctgtgattgtgatagtgtgttgaaaactgaagttatatgggtacaagtgaaaccgttgttttgaagcatgaagagatggtggtggttctg |
26181868 |
T |
|
| Q |
211 |
ggaagcctttgccatccgaagatgcttcttgacgaaatccggatcagagatgagag |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26181869 |
agaagcctttgccatccgaagatgcttcttgacgaaatccggatcagagatgagag |
26181924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University