View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16919_high_15 (Length: 310)
Name: NF16919_high_15
Description: NF16919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16919_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 78 - 124
Target Start/End: Original strand, 34035474 - 34035520
Alignment:
| Q |
78 |
gtggtcgagtccgatggcatgtatgctttctttgtaactttgcttat |
124 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
34035474 |
gtggttgagtccgatggcgtgtatgctttctttgtaattttgcttat |
34035520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 56
Target Start/End: Original strand, 34035182 - 34035229
Alignment:
| Q |
11 |
ataccaaaatattcttta--aataatttaaacaaataaaactcatctt |
56 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34035182 |
ataccaaaatattcttttttaataatttaaacaaataaaactcatctt |
34035229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 277
Target Start/End: Original strand, 34035616 - 34035649
Alignment:
| Q |
244 |
ttgctagattttgttgttatctatactatatata |
277 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
34035616 |
ttgctagattttgttgtcatctatactatatata |
34035649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University