View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16919_low_12 (Length: 387)
Name: NF16919_low_12
Description: NF16919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16919_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 44 - 221
Target Start/End: Complemental strand, 6640631 - 6640454
Alignment:
| Q |
44 |
caaatatagctcatttggcaaagatagtgtattgttatatgcaggggacgaagttccaactctagacaccccacttacttaaaaagtgaattctaaccac |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6640631 |
caaatatagctcatttggcaaagatagtgtattgttatatgcaggagacggagttctaactctagacaccccacttacttaaaaagtgaattctaacctg |
6640532 |
T |
|
| Q |
144 |
tagattacttgcctagaaaataaataagagaatgtttacatacctcataattaatgatagtatctctaaactaccctc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6640531 |
tagattacttgcctagaaaataaataagagaatgtttgcatacctcataattaatgatagcatctctaaactaccctc |
6640454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 303 - 373
Target Start/End: Complemental strand, 6640374 - 6640304
Alignment:
| Q |
303 |
gggggtaatttaaccaatgtactatttattgagattgcatatattaaatatgttcaaatacatttattaat |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6640374 |
gggggtaatttaaccaatgtactatttattgagattgcatatattaaatatgttcaactacatttattaat |
6640304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 71 - 120
Target Start/End: Original strand, 43327037 - 43327086
Alignment:
| Q |
71 |
tgtattgttatatgcaggggacgaagttccaactctagacaccccactta |
120 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||| ||| ||| |||||||| |
|
|
| T |
43327037 |
tgtattgttatatgcaggggtcgaagttcgaaccctaaacatcccactta |
43327086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 121 - 163
Target Start/End: Complemental strand, 43936675 - 43936633
Alignment:
| Q |
121 |
cttaaaaagtgaattctaaccactagattacttgcctagaaaa |
163 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||| |||| |
|
|
| T |
43936675 |
cttaaaatgtgaattctaaccactagattacttgactaaaaaa |
43936633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 124 - 168
Target Start/End: Complemental strand, 3246497 - 3246453
Alignment:
| Q |
124 |
aaaaagtgaattctaaccactagattacttgcctagaaaataaat |
168 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | | ||||||||| |
|
|
| T |
3246497 |
aaaaggtgaattctaaccactagattacttgacaaaaaaataaat |
3246453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 78 - 120
Target Start/End: Complemental strand, 29106099 - 29106057
Alignment:
| Q |
78 |
ttatatgcaggggacgaagttccaactctagacaccccactta |
120 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||||||| |
|
|
| T |
29106099 |
ttatatgcaggggccgaagttcgaaccctagacaccccactta |
29106057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University