View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16919_low_16 (Length: 338)
Name: NF16919_low_16
Description: NF16919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16919_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 16 - 324
Target Start/End: Original strand, 51670342 - 51670649
Alignment:
| Q |
16 |
atcacggtgctagtgtgatttcgtcgaactcacccgcatgcttgagtcataaattctctgttttgaaaatctagtgataatagcttgccctgacaactta |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51670342 |
atcacggtgctagtgtgattttgtcgaactcacccgcatgcttgagtcataaattctctgttttgaaaatctagtgataatagcttgccctgacatctta |
51670441 |
T |
 |
| Q |
116 |
ttatttgtcctaactattaactattacatttcaggttcaaacctaccgaattaattccgacggagtagatgtggtccaacacatgattgacgattttcag |
215 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51670442 |
ttatctgtcctaactattaactattatatttcaggttcaaacctaccgaattaattccgacggagtagatgtggtccaacatatgattgacgattttcag |
51670541 |
T |
 |
| Q |
216 |
ttataaaactttcctatactaccccccttctaacaaatagggtaaagccattattttatcttctcaagtggagacgagctgggatgtttgtggatattcc |
315 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51670542 |
ttataaaactttcctatatta-cccccttctaacaaatagggtaaagccattattttatcttctcaagtggagacgagctgggatgtttgtggatattcc |
51670640 |
T |
 |
| Q |
316 |
caccaactt |
324 |
Q |
| |
|
||||||||| |
|
|
| T |
51670641 |
caccaactt |
51670649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University