View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16919_low_25 (Length: 259)
Name: NF16919_low_25
Description: NF16919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16919_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 3322684 - 3322434
Alignment:
| Q |
1 |
aaaccaacaacatcagtggaaacatcatcttcaaaagggtatgcacaaatgtggggtggtgcatggcatgtgccttctgctttacctgattatgatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3322684 |
aaaccaacaacatcagtggaaacatcatcttcaaaagggtatgcacaaatgtggggtggtgcatggcatgtgccttctactttacctgattatgatgatt |
3322585 |
T |
 |
| Q |
101 |
ttattgctcgtcttaaagctttcactggaagatcatagaaacttaggatttaaagacacattgttgt--------aaatgtaatgatgttagattaatta |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
3322584 |
ttattgctcgtcttaaagctttcactggaagatcatagaaacttaggatttaaagacacattgttgtaaatttgtaaatgtaatgatgctagattaatta |
3322485 |
T |
 |
| Q |
193 |
ttatacacccctagtggtgcatggacttaattattttatgttagaataatat |
244 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| ||||||||| |||||| |
|
|
| T |
3322484 |
ttataca-ccctagtggtgcatcgacttaattattatatgttagactaatat |
3322434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University