View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16919_low_27 (Length: 250)
Name: NF16919_low_27
Description: NF16919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16919_low_27 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 51670122 - 51670360
Alignment:
| Q |
12 |
aatactcgcagaggaaatgatcagaggcctaacaacagtgatttgggatcgaattgatgtcagcttcagtggtagtaggcagaaatatctcgcacataat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51670122 |
aatactcgcagaggaaatgatcagaggcctaacaacagtgagttgggatcgaattgatgtcagcttcagtggtagtaggcagaaatatctcgcacataat |
51670221 |
T |
|
| Q |
112 |
gcaattcaggcaagttagtttctgctttgtgaaaatatagtgcatgtttggataaacggtgagtgaaatccttgcgtggcactgattttaacaaaagtta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51670222 |
gcaattcaggcaagttagtttctgctttgtgaaaatatagtgcatgtttggataaacggtgagtgaaatccttgcgtggcactgattttaacaaaagtta |
51670321 |
T |
|
| Q |
212 |
taatttggaacttcaataaaatcacggtgctagtgtgat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51670322 |
taatttggaacttcaataaaatcacggtgctagtgtgat |
51670360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University