View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16919_low_30 (Length: 238)
Name: NF16919_low_30
Description: NF16919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16919_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 48486013 - 48485800
Alignment:
| Q |
17 |
aaatcttgtgcaaaggttcagagaatcactcatttaagatgtctttatttccttgccttaatttatctattgctgaaatttaatttgcaacatttatggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486013 |
aaatcttgtgcaaaggttcagagaatcactcatttaagatgtttttatttccttgccttaatttatctattgctgaaatttaatttgcaacatttatggt |
48485914 |
T |
|
| Q |
117 |
tctgttcttacagttacttaaatcgaaacaatactgtggcatttgcaaaaagatttggcaccattcagatgctggtgattgggtgagatactacttctca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48485913 |
tctgttcttacagttacttaaatcgaaacaatactgtggcatttgcaaaaagatttggcaccattcagatgctggtgattgggtgagatactacttctca |
48485814 |
T |
|
| Q |
217 |
attaggtctctgct |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
48485813 |
attaggtctctgct |
48485800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 204
Target Start/End: Original strand, 10034907 - 10034987
Alignment:
| Q |
124 |
ttacagttacttaaatcgaaacaatactgtggcatttgcaaaaagatttggcaccattcagatgctggtgattgggtgaga |
204 |
Q |
| |
|
|||||||||| ||||| |||||||| ||||| ||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
10034907 |
ttacagttacgaaaatcaaaacaatattgtggaatttgcaaaaagatttggcaccattcagatggtgggaattgggtgaga |
10034987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University