View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1691_high_18 (Length: 237)
Name: NF1691_high_18
Description: NF1691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1691_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 22 - 221
Target Start/End: Original strand, 53676698 - 53676897
Alignment:
| Q |
22 |
gataacgcttcctagattctagctgtgtttgttattcgaaggcttgaaaacaagaagtagattctttagactaaattatccacttacattgagaccctct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
53676698 |
gataacgcttcctagattctagctgtgtttgttattcgaaggcttgaaaacaagaagtagattctttagattaaattatccacttacattgagcccctct |
53676797 |
T |
 |
| Q |
122 |
ccacataagaatgactcgactaaacaatcttcgacttttctaatatcaatttattatacactcggctatagaaactgacttaccctaaattttgcttcat |
221 |
Q |
| |
|
||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
53676798 |
ccatataagaatgattcgactaaacaatcttcgacttttctaatatcaattgattatacactcggctatagaaattaacttaccctaaattttgcttcat |
53676897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University