View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1691_high_22 (Length: 214)
Name: NF1691_high_22
Description: NF1691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1691_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 33332595 - 33332777
Alignment:
| Q |
18 |
gaatatgctgaagtaatctcatgaagtcgacatcacgcacctctagaataagttgcacattggcatagttattgttattggtcccaccaggtacttccac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33332595 |
gaatatgctgaagtaatctcatgaagtcgacatcacgcacctctagaataagttgcacattggcatagttattgttattggtcccaccaggtacttccac |
33332694 |
T |
 |
| Q |
118 |
aaactgattagcaattcttatatgttctgcattgattctcatgtcctctggagttgccatggcaaccaagaaaatagcatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33332695 |
aaactgattagcaattcttatatgttctgcattgattctcatgtcctctggagtagccatggcaaccaagaaaatagcatttt |
33332777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 35 - 200
Target Start/End: Original strand, 33354011 - 33354176
Alignment:
| Q |
35 |
ctcatgaagtcgacatcacgcacctctagaataagttgcacattggcatagttattgttattggtcccaccaggtacttccacaaactgattagcaattc |
134 |
Q |
| |
|
||||||||| | | ||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||| |||| |
|
|
| T |
33354011 |
ctcatgaagccaaaatcacgcacctctagaataagctgcacattggcatagttattgttatttgtcccaccaggtacttccacaaattgatcagctattc |
33354110 |
T |
 |
| Q |
135 |
ttatatgttctgcattgattctcatgtcctctggagttgccatggcaaccaagaaaatagcatttt |
200 |
Q |
| |
|
| ||||||||||||||||||||||| ||||||||||| |||||||||||||| || ||||| |||| |
|
|
| T |
33354111 |
tgatatgttctgcattgattctcatatcctctggagtagccatggcaaccaacaagatagcttttt |
33354176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University