View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1691_low_12 (Length: 293)
Name: NF1691_low_12
Description: NF1691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1691_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 276
Target Start/End: Complemental strand, 25704641 - 25704378
Alignment:
| Q |
12 |
atgaacttcaaattttagattgtcaattgttcagcaatccttaggtaaatgtggttaattaggatataggatatactactattgttgaaaaagaaaaata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
25704641 |
atgaacttcaaattttagattgtcaattgtccagcaatccttaggtaaatgtggttaattaggatataggatatacttctattgttgaaaaa------ta |
25704548 |
T |
|
| Q |
112 |
ttctagtagcatgcacgttcatttttccaaataaagaaacagtattcagatagaacgtttgtaacgttgagttatta-----aatatagtgaagaaatac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25704547 |
ttctagtagcatgcacgttcatttttccaaataaagaaacagtattcagatagaacgtttgtaacgttgagttattaaatacaatatagtgaagaaatac |
25704448 |
T |
|
| Q |
207 |
atactacacatgcatttatttattaagaaaaattcaaagtctctaaaatatatgtttaattcggattatt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25704447 |
atactacacatgcatttatttattaagaagaattcaaagtctctaaaatatatgtttaattcggattatt |
25704378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University