View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1691_low_15 (Length: 254)
Name: NF1691_low_15
Description: NF1691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1691_low_15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 70 - 254
Target Start/End: Complemental strand, 37411587 - 37411398
Alignment:
| Q |
70 |
aaagtgcaacattatcaagagctatat-----aacaaccttaaatggtagtattcaagattctccagtatatcactattctgtgatggtgagaatatacc |
164 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37411587 |
aaagtgcaacattatcaagagctatattatataacaaccttaaatggtagtattcaagattctccaatatatcactattctgtgatggtgagaatatacc |
37411488 |
T |
|
| Q |
165 |
atatcatagtataaactgctttttatacatgtcaaacaactccgaggatgataattgtgcctcctgcaaatccaaatccaaatccaaatc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37411487 |
atatcatagtataaactgctttttatacatgtcaaacaactccgaggatgataattgtgcctcctgcaaatccaaatccaaatccaaatc |
37411398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University