View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1691_low_16 (Length: 252)
Name: NF1691_low_16
Description: NF1691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1691_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 6 - 193
Target Start/End: Original strand, 30107811 - 30107998
Alignment:
| Q |
6 |
agcagcacagagtgaacggtatggcaggattttggctctttgccatagacaacactaatacaaggtgaaaacctaaacaaattataagattaaacgacat |
105 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30107811 |
agcaccacaaagtgaacggtatggcaggattttggctctttgccatagacaacactaatacaaggtgaaaacctaaacaaattataagattaaacgacat |
30107910 |
T |
|
| Q |
106 |
ttgcagcaaattttgtgcttttaaatgtttccttcatacgcgacacaatattcaaaagcaatattctaccatctctccagtaggcttc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30107911 |
atgcagcaaattttgtgcttttaaatgtttccttcatacgcgacacaatatttaaaagcaatattctaccatctctgcagtaggcttc |
30107998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 51
Target Start/End: Original strand, 14109264 - 14109304
Alignment:
| Q |
11 |
cacagagtgaacggtatggcaggattttggctctttgccat |
51 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
14109264 |
cacagagtgtccggtatggcaggattttggctctctgccat |
14109304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University