View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1691_low_18 (Length: 245)
Name: NF1691_low_18
Description: NF1691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1691_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 11 - 229
Target Start/End: Complemental strand, 7626809 - 7626592
Alignment:
| Q |
11 |
cacagacccaccaaatatcacactaatattgatgtattaacatcagcaatgattnnnnnnnntgaaaataattgaatataattatatcctaccgttatga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7626809 |
cacagacccaccaaatatcacactaatattgatgtattaacatcaacaatgattaaaaaaa-tgaaaataattgaatataattatatcctatcgttatga |
7626711 |
T |
 |
| Q |
111 |
ttatatgattcgtgcaatcaatataacgcgtgttggatacaagacacacttttaatcgtggtaggattgaagcaagaatcagccaagattaggatttgtt |
210 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7626710 |
tcatatgattcgtgcaatcaatataacgcgtgttggatacctgacacactttcaatcgtggtaggattgaagcaaaaatcagccaagattaggatttgtt |
7626611 |
T |
 |
| Q |
211 |
ttgattgaagagaacgtac |
229 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7626610 |
ttgattgaagagaacgtac |
7626592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University