View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1691_low_7 (Length: 347)
Name: NF1691_low_7
Description: NF1691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1691_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 18 - 339
Target Start/End: Complemental strand, 24264554 - 24264233
Alignment:
| Q |
18 |
caaacctcagcgtgcaccaaatatctcctgcggtggatcataaatactggaatcaggaaagatctcttcaaaatcttgtttcactttgtttctcaaaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24264554 |
caaacctcagcgtgcaccaaatatctcctgcggtggatcataaatactggaatcaggaaagatctcttcaaaatcttgtttcactttgtttctcaaaaga |
24264455 |
T |
 |
| Q |
118 |
ggatgtggcaggagacctttcaacaaaattctgaatggcaactcctctggtggatctggagaattcttcatgtcctcatatacgttcattgcatctgcag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24264454 |
ggatgtggcaggagacctttcaacaaaattctgaatggcaactcctctggtggatctggagaattcttcatgtcctcatatacgttcatcgcatctgcag |
24264355 |
T |
 |
| Q |
218 |
gagatccactactcaagaagccccgtatgacttcagtataagtctgagaatcagggaacagattctccttcctcatactttcccacaattgcaacacatc |
317 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24264354 |
gagatccgctactcaagaagccccgtatgacttcagtataagtctgagaatcagggaacagattctccttcctcatactttcccacagttgcaacacatc |
24264255 |
T |
 |
| Q |
318 |
atccattcttttcgcctttgct |
339 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
24264254 |
atccattcttttcgcccttgct |
24264233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University