View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16921_high_22 (Length: 299)
Name: NF16921_high_22
Description: NF16921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16921_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 285
Target Start/End: Complemental strand, 55377577 - 55377302
Alignment:
| Q |
19 |
aattcatctgcaacccagacactttcatcaggatccctacccaccgccatcatcatcatcatc---------tctttcttcttcagtgtatgcataaaca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55377577 |
aattcatctgcaacccagacactttcatcagaatccctacccaccggcatcatcatcatcatcatcatcatctctttcttcttcagtgtatgcataaaca |
55377478 |
T |
 |
| Q |
110 |
attctcnnnnnnnnnnnnnnnnnnnctcatttctcacctcactcttttctttttgatgcagcacccaaaacaactacaacaagacactgtattttgtctt |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55377477 |
attctctattatattatattatattctcatttctcacctcactcttttctttttgatgcagcacccaaaacaactacaacaagacactgtattttgtctt |
55377378 |
T |
 |
| Q |
210 |
cttcaacggcactccttgatttcaaatttgatgttgctcctgctgaatctgaaaactcaccaccttggccctatgc |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55377377 |
cttcaacggcactccttgatttcaaatttgatgttgctcctgctgaatctgaaaactcaccaccttggccctatgc |
55377302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University