View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16921_high_26 (Length: 241)
Name: NF16921_high_26
Description: NF16921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16921_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 98 - 227
Target Start/End: Complemental strand, 22016363 - 22016230
Alignment:
| Q |
98 |
agctagaggtggattgaaactcaggcagctttt-ccaacacggtatgtatatgctaggagggaaaacaactgaacaacaacaaaaccttttcttactagt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22016363 |
agctagaggtggattgaaactcaggcagctttttccaacacagtacgtacatgctaggagggaaaacaactgaacaacaacaaaaccttttctcactagt |
22016264 |
T |
|
| Q |
197 |
gggcttaactaca---atcaaaacctgtcataaa |
227 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| |
|
|
| T |
22016263 |
cggcttaactacagccatcaaaacctgtcttaaa |
22016230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 22016483 - 22016398
Alignment:
| Q |
15 |
actattaaagccatatttctagaggatgtgaaactaaagtcaaaacacactcttcacaccagcacaacaaagatactagaggaagc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016483 |
actattaaagccatatttctagatgatgtgaaactaaagtcaaaacacactcttcacaccagcacaacaaagatactagaggaagc |
22016398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University