View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16922_high_6 (Length: 364)
Name: NF16922_high_6
Description: NF16922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16922_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 10 - 348
Target Start/End: Complemental strand, 421131 - 420795
Alignment:
| Q |
10 |
caacgtgattttaatttcatttcatttgacaggtacttattttttctagagagacatgttggactatgaatggggtaacccatcaaacatcatgcttacc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421131 |
caacgtgattttaatttcatttcatttgacaggtactt--tttttctagagagacatgttggactatgaatggggtaacccatcaaacatcatgcttacc |
421034 |
T |
 |
| Q |
110 |
ggaaatgaagacaactccggtgcagcagccaccgatcaagcccaccgtcaaatcttcgaccactatgcttctcaagctatgttatccgacaactacctta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421033 |
ggaaatgaagacaactccggtgcagcagccaccgatcaagcccaccgtcaaatcttcgaccactatgcttctcaagctatgttatccgacaactacctta |
420934 |
T |
 |
| Q |
210 |
acggacctggtggtggacccaccatcgacataaacagtggtgattttactcatcaccacaaccagtttagcccacacgcccagcagcaccataatatcca |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
420933 |
acggacctggtggtggacccaccatcgacataaacagtggtgattttactcatcaccacaaccagtttagcccacacaaccagcagcaccataatatcca |
420834 |
T |
 |
| Q |
310 |
tcagtccttcttcgacccacgggcttttcatggagggtc |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
420833 |
tcagtccttcttcgacccacgggcttttcatggagggtc |
420795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University