View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16922_low_11 (Length: 278)
Name: NF16922_low_11
Description: NF16922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16922_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 421166 - 421379
Alignment:
| Q |
1 |
tataaaagtcattctttatttttggaggtgtaaatagcaataagatagccctaacctaatttgctgaaaagttatggttgggnnnnnnnnnnnnctttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
421166 |
tataaaagtcattctttatttttggaggtgtaaatagcaataagatagccctaacctaatttgctgaaaagttatggttggggagagaga----ctttat |
421261 |
T |
 |
| Q |
101 |
ctatccatccatctatctaactcatttcatttgattcagagaaaacagtgtgtaatgtaatggcgtgtacattaagtctattatcacacacactctctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
421262 |
ctatccatccatctatctaactcatttcatttgattcagagaaaacagtgtgtaatgtaatggcgtgtacattaagtctattatcacacaca--ctctct |
421359 |
T |
 |
| Q |
201 |
ctcactatcactataactat |
220 |
Q |
| |
|
|||||||| ||||||||||| |
|
|
| T |
421360 |
ctcactataactataactat |
421379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University