View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16923_low_17 (Length: 325)
Name: NF16923_low_17
Description: NF16923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16923_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 16 - 142
Target Start/End: Original strand, 10814937 - 10815060
Alignment:
| Q |
16 |
gtggatttaggacggtgacttagttggttcaaacttttgagttcttcttgaactttttaaggaagtggtgaaaacaaattcacggggttcaaaatgcaaa |
115 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10814937 |
gtggatttaggaccgtgatttaggtggttcaaacttttgagttct---tgaactttttaagccagtggtgaaaacaaattcacggggttcaaaatgtaaa |
10815033 |
T |
|
| Q |
116 |
ataaggtatatttgcattttgtttaag |
142 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
10815034 |
ataaggtatatttgcattttgtctaag |
10815060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 167 - 288
Target Start/End: Original strand, 6945120 - 6945242
Alignment:
| Q |
167 |
gttttgagttgacacacaatcagttggaaagataaaaaccaaaagagaggatacttattctaatttggtgtattaaaattgtctttgttcttaaattta- |
265 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| ||||| ||| ||||||||| ||| |||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
6945120 |
gttttgagttgacacacaattagttggaaaga-aaaaatcaaaacagatgatacttatactactttggtttattaaaattgtctttattctttgatttat |
6945218 |
T |
|
| Q |
266 |
-tgtgatttgaaaaactaaaacaa |
288 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
6945219 |
ttgtgatttgaaaaactgaaacaa |
6945242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University