View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16924_low_4 (Length: 212)
Name: NF16924_low_4
Description: NF16924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16924_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 12870557 - 12870385
Alignment:
| Q |
18 |
aataataatattattcctcagctcccaaatttcccacatggtcgatggttgtatgccaaattaacattaaccatttctaatgcttatgatttgaggaaga |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12870557 |
aataataataatattcctcagctcccaaatttcccacatggtcgatggttgtatgccaaattaacattaaccatttctaatgcttatgatttgaggaaga |
12870458 |
T |
|
| Q |
118 |
gggtgataatgttcccaggctaggtcacaatcgtaacgacccgtttgaaaatatgatacctaaccgaaccggc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12870457 |
gggtgataatgttcccaggctaggtcacaatcgtaaccacccgtttgaaaatatgatacctaaccgaaccggc |
12870385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University