View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16926_high_18 (Length: 212)
Name: NF16926_high_18
Description: NF16926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16926_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 44055669 - 44055472
Alignment:
| Q |
1 |
ttttcttgcttgcattggcaaaattgttggaactctagctgttgcaatctattatcaaatgccgattcgcgaaggtgctacccttggcttactcatgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44055669 |
ttttcttgcttgcattggcaaaattgttggaactctagctgttgcaatctattatcgaatgccgattcgtgaaggtgctacccttggcttactcatgaac |
44055570 |
T |
|
| Q |
101 |
acaaaaggactagttgaaatgattgtgctcaatgttggaaaggaccaaaaggtgcaaatacaatactactattgattgctatttgtggtttgcttatt |
198 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44055569 |
actaaaggactagttgaaatgattgtgctcaatgttggaaaggaccaaaaggtgcaaatacaatactactaatgattgctatttgtggtttgcttatt |
44055472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 153
Target Start/End: Original strand, 2811915 - 2811985
Alignment:
| Q |
83 |
cttggcttactcatgaacacaaaaggactagttgaaatgattgtgctcaatgttggaaaggaccaaaaggt |
153 |
Q |
| |
|
||||| ||||| |||||||| ||||| || |||||||||||||||||||| |||| | ||| |||||||| |
|
|
| T |
2811915 |
cttggtttacttatgaacaccaaaggtcttattgaaatgattgtgctcaatattgggagggaacaaaaggt |
2811985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University