View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16926_high_7 (Length: 324)
Name: NF16926_high_7
Description: NF16926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16926_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 8e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 48543972 - 48543850
Alignment:
| Q |
1 |
cggcaatcattcaaatgaattgcgtctagagcagagcatgactcactacatatcttcttccacatgccacaattatataggacctgttcttatttcaaat |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48543972 |
cggcaatcattcaaataaattgcgtctagagca-----tgactcactacatatcttcttccacatgccacaattatataggacctgttcttatttcaaat |
48543878 |
T |
|
| Q |
101 |
tgacataatcctgatcttggttaggatt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
48543877 |
tgacataatcctgatcttggttaggatt |
48543850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 42113306 - 42113246
Alignment:
| Q |
191 |
gtagtatctacataaatcattgataattaagattaccccacaaaaagatgttggatggtgg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42113306 |
gtagtatctacataaatcattgataattaagattaccacacaaaaagatgttggatggtgg |
42113246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University