View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16926_low_11 (Length: 269)
Name: NF16926_low_11
Description: NF16926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16926_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 39 - 259
Target Start/End: Original strand, 53562332 - 53562552
Alignment:
| Q |
39 |
gtcaaggttttgtcttggaggtggagtttgggaagattaaagttgccggcgtttttgttctacgagtggacgtggaatcccaaggactgtttgatgcggt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53562332 |
gtcaaggttttgtcttggaggtggagtttgggaagattaaagttgccggcgtttttgttctacgagtggaagtggaatcccaaggactgtttgatgcggt |
53562431 |
T |
 |
| Q |
139 |
gaggttgttttgtttgggagagctgctgctgcgtggtgtctggctgtgttcattgaggttgtgcagttctgttgtggtgctgctggtttttctgtttgca |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53562432 |
gaggttgttttgtttgggagagctgctgctgcgtggtgtctggctgtgttcattgaggctgtgcagttctgttgtggtgctgctggtttttctgtttgca |
53562531 |
T |
 |
| Q |
239 |
gcagctcttatgctttctgtg |
259 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
53562532 |
gcagctcttatgctttctgtg |
53562552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University