View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16926_low_13 (Length: 256)
Name: NF16926_low_13
Description: NF16926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16926_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 11 - 208
Target Start/End: Original strand, 8016561 - 8016755
Alignment:
| Q |
11 |
atcatcatcatcatgtcaataataataaaaataacaaacaaggaagagtggatcatcagagataacatatttattagtgtatgacatacgacatacatac |
110 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016561 |
atcatcatcatcatgtcaata---ataaaaataacaaacaaggaagagtggatcatcagagataacatatttattagtgtatgacatacgacatacatac |
8016657 |
T |
 |
| Q |
111 |
ccggagggaagagtgtggacataagttggtatcatgggaagcccgggcccatcaacggaggaaagcccagcccgcatttcagaagacattgcatcagc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016658 |
ccggagggaagagtgtggacataagttggtatcatgggaagcccgggcccatcaacggaggaaagcccagcccgcatttcagaagacattgcatcagc |
8016755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University