View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16926_low_17 (Length: 217)
Name: NF16926_low_17
Description: NF16926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16926_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 311454 - 311638
Alignment:
| Q |
15 |
cagagagaagaacgttgttgctttcattgttgatgagggtggtggttttgtggttgattgaaatagaacaagttgttcggcgtttgtgatgagggatgat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
311454 |
cagagagaagaacgttgttgctttcattgttgatgagggtgttggttttgtggttgattgaaatagaacatgttgttcggcgtttgtgttgagggttgat |
311553 |
T |
 |
| Q |
115 |
tagattattaggttggaaagagagaagacgagacgaaggtgagaaatgggaagttacagtcataccccccatacccaaacctaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
311554 |
tagattattaggttggaaagagagaagacgagatgaaggtgagaaatgggaagttacagtcataccccccatacccaaacctaaa |
311638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University