View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16926_low_18 (Length: 217)
Name: NF16926_low_18
Description: NF16926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16926_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 202
Target Start/End: Complemental strand, 34978754 - 34978564
Alignment:
| Q |
14 |
cacagatcactcactcactttattcacctgacacatctgcatgtactttagatcggggtgtgttcctcacgccaaccatatcatatatcctataataatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34978754 |
cacagatcactcactcactttattcacctgacacatctgcatgtactttagatcggggtgtgttcctcacgccaaccatatc--atatcctataataatc |
34978657 |
T |
|
| Q |
114 |
ttactcatcttc----tacttaatatggatataaagataacatccctctcgtttctctttctggtgtcacccttcctatggaagctttttagt |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34978656 |
ttactcatcttctacgtacttaatatggatataaagataacatccctctcgtttctctttctggtgtcacccttcctatggaagctttttagt |
34978564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University