View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16926_low_20 (Length: 210)
Name: NF16926_low_20
Description: NF16926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16926_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 20452296 - 20452077
Alignment:
| Q |
1 |
taactcaatttaggttatgtttctagatttgattttcagttgaggcgtgtgaaggtttattttgttgtagttgtatgtttggatacaatttctagat--- |
97 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20452296 |
taactcaatttaggttatttttctagatttgattttcagttgaggagtgtgaaggtttattttgttgtagttatatgtttggatacaatttctagatttg |
20452197 |
T |
 |
| Q |
98 |
-------------------tttctatacttgtgttggtctggttcttcaatccagttaaaatgataatatgaaatgtgttcaaattgattgtaatttgta |
178 |
Q |
| |
|
||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20452196 |
attttatatgaatttacaatttctttacttgtgttggtctggttcttcaatacatttaaaatgataatatgaaatgtgttcaaattgattgtaatttgta |
20452097 |
T |
 |
| Q |
179 |
gttatagtttttggtctctg |
198 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
20452096 |
gttatagcttttggtctctg |
20452077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 25463673 - 25463454
Alignment:
| Q |
1 |
taactcaatttaggttatgtttctagatttgattttcagttgaggcgtgtgaaggtttattttgttgtagttgtatgtttggatacaatttctagat--- |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
25463673 |
taactcaatttaggttatgtttctagatttgattttcagttgaggcatgtgaaggtttattttgctgtagctgtatgtttggatacaatttctagatttg |
25463574 |
T |
 |
| Q |
98 |
-------------------tttctatacttgtgttggtctggttcttcaatccagttaaaatgataatatgaaatgtgttcaaattgattgtaatttgta |
178 |
Q |
| |
|
||||| ||||||||||| || |||||| |||| || ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25463573 |
agtttatatgaatttacaatttctttacttgtgttgttcaggttctccaatacatttaaaatgataatatgaaatgcaatcaaattgattgtaatttgta |
25463474 |
T |
 |
| Q |
179 |
gttatagtttttggtctctg |
198 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
25463473 |
gttatactttttggtctctg |
25463454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 5368421 - 5368357
Alignment:
| Q |
134 |
ttaaaatgataatatgaaatgtgttcaaattgattgtaatttgtagttatagtttttggtctctg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5368421 |
ttaaaatgataatatgaaatgtgttcaaattgattgtaatttgtagttatagtttttggtctctg |
5368357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University